Review



n ha he6ap encoding e6ap  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc n ha he6ap encoding e6ap
    N Ha He6ap Encoding E6ap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/p6895+PHAGE-P+CMVT+N-HA-hE6AP+I+wt+(Plasmid+%2337601)/10__3390_slash_cells15050415-49-2-41
    Average 94 stars, based on 4 article reviews
    n ha he6ap encoding e6ap - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: All- trans retinoic acid downregulates HBx levels via E6-associated protein-mediated proteasomal degradation to suppress hepatitis B virus replication
    Article Snippet: .. Plasmid cMVT N-HA-hE6AP with human HA-tagged E6AP (amino acids 262–853) and pCH110 which encodes the Escherichia coli β-galactosidase gene were acquired from Addgene (Watertown, MA, USA). .. The plasmid RC210241 (Cat No. 003049), including the human Na+ -taurocholate co-transporting polypeptide (NTCP), was purchased from OriGene (Rockville, MD, USA).



    Similar Products

    94
    Addgene inc n ha he6ap encoding e6ap
    N Ha He6ap Encoding E6ap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/p6895+PHAGE-P+CMVT+N-HA-hE6AP+I+wt+(Plasmid+%2337601)/10__3390_slash_cells15050415-49-2-41
    Average 94 stars, based on 1 article reviews
    n ha he6ap encoding e6ap - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    88
    Addgene inc caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn
    Caaggagctgactgtcatctgg 30 Thermofisher N A Primer Pxdn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/p6898+PHAGE-P+CMVT+N-HA-hE6AP+I+C820A+(Plasmid+%2337602)/pm39991542-873-33-45
    Average 88 stars, based on 1 article reviews
    caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn - by Bioz Stars, 2026-10
    88/100 stars
      Buy from Supplier

    88
    Addgene inc p6898 phage p cmvt n ha he6ap i c820a
    <t>UBE3A</t> overexpression can independently induce AR reduction by increasing ubiquitination and degradation of AR (A) Representative images of immunocytochemistry for AR (red) at DIV 8 in rat cortical neuron cultures after transfected with GFP alone or together with UBE3A at DIV4. Scale bars, 25 μm. (B) UBE3A overexpression reduced AR intensity in primary culture neurons. GFP: n = 22, GFP+UBE3A: n = 19. (C and D) AR mRNA expression detected by qPCR was not altered in Tg males and Tg females at postnatal day 0 (C) and postnatal day 21 (D) in prefrontal cortex. P0: n = 7 animals/group; P21: n = 7 animals/group. (E) Degradation assay of AR with or without UBE3A. Transfected HEK cells were treated with cycloheximide (CHX) for various time points and cell lysates were collected to examine AR levels by western blot. (F) Quantification of the degradation rate of AR over time; n = 4 independent experiments. (G) AR ubiquitination assay. HEK293T cells were transfected with AR, HA-ubiquitin (Ubi), and either a vector control, UBE3A, or the E3 ligase dead mutant UBE3A <t>C820A</t> for 2 days. AR was immunoprecipitated and probed for ubiquitin. Cell lysates (input) were also probed to detect total protein levels. (H and I) AR ubiquitination assays using lysates of neurons infected with AAV2 GFP or AAV2 UBE3A virus for 10 days (H). Increased intensity of ubiquitination signals on AR was detected (I). n = 3 independent experiments. (J and K) AR was immunoprecipitated from brain lysates and probed for ubiquitin signals. An elevated level in AR ubiquitination was detected in Ube3A 2xTg mice compared to WT. n = 6 animals/group. Mean ± SEM. ∗ p < 0.05; ∗∗ p < 0.01. ns, not significant. In (C), (D), and (F) two-way ANOVA with Bonferroni’s multiple comparisons test; In (B), (I), and (K) Unpaired two-tailed t test.
    P6898 Phage P Cmvt N Ha He6ap I C820a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/p6898+PHAGE-P+CMVT+N-HA-hE6AP+I+C820A+(Plasmid+%2337602)/pmc11847089-69-0-8
    Average 88 stars, based on 1 article reviews
    p6898 phage p cmvt n ha he6ap i c820a - by Bioz Stars, 2026-10
    88/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid cmvt n ha he6ap
    <t>UBE3A</t> overexpression can independently induce AR reduction by increasing ubiquitination and degradation of AR (A) Representative images of immunocytochemistry for AR (red) at DIV 8 in rat cortical neuron cultures after transfected with GFP alone or together with UBE3A at DIV4. Scale bars, 25 μm. (B) UBE3A overexpression reduced AR intensity in primary culture neurons. GFP: n = 22, GFP+UBE3A: n = 19. (C and D) AR mRNA expression detected by qPCR was not altered in Tg males and Tg females at postnatal day 0 (C) and postnatal day 21 (D) in prefrontal cortex. P0: n = 7 animals/group; P21: n = 7 animals/group. (E) Degradation assay of AR with or without UBE3A. Transfected HEK cells were treated with cycloheximide (CHX) for various time points and cell lysates were collected to examine AR levels by western blot. (F) Quantification of the degradation rate of AR over time; n = 4 independent experiments. (G) AR ubiquitination assay. HEK293T cells were transfected with AR, HA-ubiquitin (Ubi), and either a vector control, UBE3A, or the E3 ligase dead mutant UBE3A <t>C820A</t> for 2 days. AR was immunoprecipitated and probed for ubiquitin. Cell lysates (input) were also probed to detect total protein levels. (H and I) AR ubiquitination assays using lysates of neurons infected with AAV2 GFP or AAV2 UBE3A virus for 10 days (H). Increased intensity of ubiquitination signals on AR was detected (I). n = 3 independent experiments. (J and K) AR was immunoprecipitated from brain lysates and probed for ubiquitin signals. An elevated level in AR ubiquitination was detected in Ube3A 2xTg mice compared to WT. n = 6 animals/group. Mean ± SEM. ∗ p < 0.05; ∗∗ p < 0.01. ns, not significant. In (C), (D), and (F) two-way ANOVA with Bonferroni’s multiple comparisons test; In (B), (I), and (K) Unpaired two-tailed t test.
    Plasmid Cmvt N Ha He6ap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/PHAGE-P+CMVt+N-HA+hE6AP+III+(C41A%2C+C46A%2C+C840A)+(Plasmid+%23119318)/pmc11166335-39-0-22
    Average 93 stars, based on 1 article reviews
    plasmid cmvt n ha he6ap - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    92
    Addgene inc plasmid pcmvt n ha he6ap
    <t>UBE3A</t> overexpression can independently induce AR reduction by increasing ubiquitination and degradation of AR (A) Representative images of immunocytochemistry for AR (red) at DIV 8 in rat cortical neuron cultures after transfected with GFP alone or together with UBE3A at DIV4. Scale bars, 25 μm. (B) UBE3A overexpression reduced AR intensity in primary culture neurons. GFP: n = 22, GFP+UBE3A: n = 19. (C and D) AR mRNA expression detected by qPCR was not altered in Tg males and Tg females at postnatal day 0 (C) and postnatal day 21 (D) in prefrontal cortex. P0: n = 7 animals/group; P21: n = 7 animals/group. (E) Degradation assay of AR with or without UBE3A. Transfected HEK cells were treated with cycloheximide (CHX) for various time points and cell lysates were collected to examine AR levels by western blot. (F) Quantification of the degradation rate of AR over time; n = 4 independent experiments. (G) AR ubiquitination assay. HEK293T cells were transfected with AR, HA-ubiquitin (Ubi), and either a vector control, UBE3A, or the E3 ligase dead mutant UBE3A <t>C820A</t> for 2 days. AR was immunoprecipitated and probed for ubiquitin. Cell lysates (input) were also probed to detect total protein levels. (H and I) AR ubiquitination assays using lysates of neurons infected with AAV2 GFP or AAV2 UBE3A virus for 10 days (H). Increased intensity of ubiquitination signals on AR was detected (I). n = 3 independent experiments. (J and K) AR was immunoprecipitated from brain lysates and probed for ubiquitin signals. An elevated level in AR ubiquitination was detected in Ube3A 2xTg mice compared to WT. n = 6 animals/group. Mean ± SEM. ∗ p < 0.05; ∗∗ p < 0.01. ns, not significant. In (C), (D), and (F) two-way ANOVA with Bonferroni’s multiple comparisons test; In (B), (I), and (K) Unpaired two-tailed t test.
    Plasmid Pcmvt N Ha He6ap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/PHAGE-P+CMVt+N-HA+hE6-AP+I+(C21Y)+(Plasmid+%23119304)/pm38201266-41-1-13
    Average 92 stars, based on 1 article reviews
    plasmid pcmvt n ha he6ap - by Bioz Stars, 2026-10
    92/100 stars
      Buy from Supplier

    91
    Addgene inc human ube3a isoform iii
    VMHvl Tac1 neurons drive attack behavior and are the site where increased <t>Ube3a</t> gene dosage modeling a genetic ASD heightens aggression. (A) Representative images and traces of calcium events in three VMHvl Tac1 neurons expressing GCaMP7 recorded using Inscopix miniature microscope with implanted GRIN lens when the resident male in its home- cage is exposed to a male intruder (resident-intruder paradigm). (B) Left: diagram of stereotactic injections of AAV virus in Tac1-Cre ( Tac1 tm1.1(cre)Hze ) or Pgr-Cre ( Pgr tm1.1(cre)Shah ) mice. Right: upper panel: total attack time/number in Tac1-Cre mice ( n =7) injected with AAV-DIO- hM3D(Gq)-RFP, comparing application of saline and CNO (1 mg/kg i.p.). P value of total attack time ( P T ) = 0.0068, and P value of attack number ( P N ) = 0.0042. Lower panel: total attack time/number in Pgr-Cre mice ( n =7) injected with AAV-DIO-hM3D(Gq)-RFP, comparing application of saline and CNO (1 mg/kg i.p., P T = 0.0038, P N = 0.0165). ( C-E ) Total attack time and attack number in C, VGluT2-Cre ( Slc17a6 tm2(cre)Lowl ): LoxTB-Ube3a-2x mice ( n = 14) comparing LoxTB-Ube3a-2x littermates ( n = 9) ( P T = 0.026, P N = 0.042); D , Vgat -Cre ( Slc32a1 tm2(cre)Lowl ) :LoxTB-Ube3a-2x mice ( n =14) and LoxTB-Ube3a-2x littermates ( n = 12) ( P T = 0.9007, P N = 0.8203); E , Sf1-Cre (Tg(Nr5a1-cre)7Lowl): LoxTB-Ube3a-2x mice ( n = 14) and LoxTB-Ube3a-2x littermates ( n = 14) ( PT = 0.0056, P N = 0.0085). Below, anti-FLAG antibody immunofluorescence in ventromedial hypothalamus (VMH), scale bars 200 μm. ( F ) Left: upper panel: diagram of construct of AAV-hSyn-DIO-Ube3a and stereotactic injections. Lower panel: representative image of anti-GFP antibody immunofluorescence in VGluT2 -Cre mice injected with AAV-hSyn-DIO-Ube3a and AAV-hSyn-DIO-GFP in VMHvl, scale bar, 50 μm. Right: total attack time/number in VGluT2 -Cre mice injected with AAV-hSyn-DIO- Ube3a:AAV-DIO-GFP ( n = 16), compared to wild type littermates with AAV-CMV-GFP ( n = 11, P T = 0.0373, P N = 0.0394) in VMHvl. ( G ) Left: diagram of construct of Cre-inactivate-able Ube3a BAC Transgenic ( Ube3a OFF#5; figS2I, a conditional Ube3a transgene where LoxP site flank exons of the full-length untagged Ube3a gene) and stereotactic injections. Right: total attack time/number in Ube3a OFF#5 mice injected with AAV-CMV-CreGFP ( n = 25) in VMHvl compared to AAV-CMV-GFP ( n = 18, P T = 0.0146, P N = 0.0385). ( H ) Left: diagram of construct of AAV-hSyn-DIO-Ube3a, stereotactic injections. Middle: representative image of anti-GFP antibody immunofluorescence staining in Tac1 Cre mice injected with AAV-hSyn-DIO- Ube3a and AAV-hSyn-DIO-GFP in VMHvl (scale bar, 50 μm). Right: total attack time/number in Tac1-Cre mice injected with AAV-hSyn-DIO-Ube3a:AAV-DIO-GFP ( n = 11) in VMHvl, compared to wild type littermates injected with AAV-CMV-GFP ( n = 16, P T = 0.025, P N = 0.0443). ( I ) Total attack time/number in Pgr-Cre mice injected with AAV-hSyn-DIO- Ube3a:AAV-DIO-GFP ( n = 17) in VMHvl, compared to wild type littermates injected with AAV-CMV-GFP ( n = 10, P T = 0.026, P N = 0.032). ( J ) Total attack time/number in wild type ( n = 23) mice, comparing with Ube3a-1x ( n = 10, P T = ns, P N =ns); with Ube3a-NLS3-1x mice ( n = 12, P T < 0.0001, P N < 0.0001); and with Ube3a-NLS7-1x mice ( n = 8, P T < 0.0001, P N < 0.0001). ( K ) Total attack time/number in Tac1-Cre mice injected with AAV-DIO-GFP + AAV-DIO- Ube3a-NLS ( n =11) in VMHvl, compared to AAV-DIO-GFP ( n = 11) ( P T =0.0130, P N =0.0183). ( L ) Calcium events in VMHvl Tac1 neurons recorded using Inscopix miniature microscope, compared Tac1-Cre mice injected with AAV9-hSyn-DIO-GCaMP7f ( n = 7 cells) to AAV-DIO- Ube3a-NLS:AAV9-hSyn-DIO-GCaMP7f ( n = 17 cells, P =0.0261; unpaired T-test with Welch’s correction). Unpaired two-tailed Student’s t-test was used to determine statistical significance when comparing two groups. Comparisons across two groups before and after CNO treatment analyzed by paired two-tailed Student’s t-test. Multiple groups were analyzed using 1-way ANOVA followed by Bonferroni’s Multiple Comparison Correction. Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01.
    Human Ube3a Isoform Iii, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/p6897+PHAGE-P+CMVT+N-HA-hE6AP+III+wt+(Plasmid+%2337605)/bio_rxiv__2023__02__28__530462-279-12-19
    Average 91 stars, based on 1 article reviews
    human ube3a isoform iii - by Bioz Stars, 2026-10
    91/100 stars
      Buy from Supplier

    94
    Addgene inc e6ap expression plasmid pcmvt n ha he6ap
    HBx stabilizes HCV core protein by protecting it from ubiquitin-dependent proteasomal degradation. (A) HepG2 cells were transfected with HA-Core with or without HA-HBx for 48 h, treated with 50 μM cycloheximide (CHX) for the indicated times, and collected for Western blotting. The band intensity of HA-Core was quantified as described in the legend of <xref ref-type=Fig. 1A to determine the half-life ( t 1/2 ) of the HCV core protein ( n = 4). (B) Huh7D cells were transfected with the 1.2-mer WT replicon and then infected with HCV at an MOI of 10 for an additional 48 h. The t 1/2 value of the HCV core protein was determined as described above for panel A. (C) Huh7D-NTCP cells were coinfected with HBV at an MOI of 30 and HCV at an MOI of 10 for 48 h. The t 1/2 value of the HCV core protein was determined as described above for panel A. (D) HepG2 cells were transfected with HA-HBx, HA-Core, an E6AP expression plasmid, and HA-ubiquitin (HA-Ub) for 48 h. Total HA-Core proteins were immunoprecipitated with an anti-HCV core protein antibody and subjected to Western blotting using an anti-HA antibody to detect polyubiquitinated HA-Core. The input shows the levels of the indicated proteins in whole-cell lysates. (E) HepG2 cells were transfected with the indicated amounts of HA-HBx, HA-Core, scrambled (SC) shRNA, and E6AP shRNA for 48 h, and samples were collected for immunoprecipitation (IP), as described above for panel D. (F) Huh7D-NTCP cells were transfected with an empty vector, an E6AP expression plasmid, and HA-Ub for 24 h and then monoinfected with HCV or coinfected with HBV and HCV for 48 h as described above for panel C, and samples were collected for IP as described above for panel D. (G) Huh7D cells were transfected with an empty vector, the 1.2-mer WT replicon, an E6AP expression plasmid, and HA-Ub for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. (H) HepG2 cells were transfected with either HA-HBx or HA-Core, followed by Western blot analysis. (I) HepG2 cells were transfected with the indicated amounts of HA-HBx, HA-Core, and an E6AP expression plasmid for 48 h. (J) Huh7D cells were transfected with the 1.2-mer WT replicon and an E6AP expression plasmid for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. (K) Huh7D-NTCP cells were transfected with either an empty vector or an E6AP expression plasmid for 24 h and then either mock infected or infected with HBV at an MOI of 30 and/or HCV at an MOI of 10 for an additional 48 h. (L) HepG2 cells were transfected with the indicated amounts of HA-HBx and HA-Core for 44 h and then either mock treated or treated with 10 μM MG132 for an additional 4 h. (M) HepG2 cells were transfected with the 1.2-mer WT replicon and then infected with HCV as described above for panel J. For lanes 4 to 6, cells were either mock treated or treated with 10 μM MG132 for 4 h before harvest. " width="250" height="auto" />
    E6ap Expression Plasmid Pcmvt N Ha He6ap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+cmvt+n+ha+he6ap/p6895+PHAGE-P+CMVT+N-HA-hE6AP+I+wt+(Plasmid+%2337601)/pmc09784765-147-1-17
    Average 94 stars, based on 1 article reviews
    e6ap expression plasmid pcmvt n ha he6ap - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    Image Search Results


    UBE3A overexpression can independently induce AR reduction by increasing ubiquitination and degradation of AR (A) Representative images of immunocytochemistry for AR (red) at DIV 8 in rat cortical neuron cultures after transfected with GFP alone or together with UBE3A at DIV4. Scale bars, 25 μm. (B) UBE3A overexpression reduced AR intensity in primary culture neurons. GFP: n = 22, GFP+UBE3A: n = 19. (C and D) AR mRNA expression detected by qPCR was not altered in Tg males and Tg females at postnatal day 0 (C) and postnatal day 21 (D) in prefrontal cortex. P0: n = 7 animals/group; P21: n = 7 animals/group. (E) Degradation assay of AR with or without UBE3A. Transfected HEK cells were treated with cycloheximide (CHX) for various time points and cell lysates were collected to examine AR levels by western blot. (F) Quantification of the degradation rate of AR over time; n = 4 independent experiments. (G) AR ubiquitination assay. HEK293T cells were transfected with AR, HA-ubiquitin (Ubi), and either a vector control, UBE3A, or the E3 ligase dead mutant UBE3A C820A for 2 days. AR was immunoprecipitated and probed for ubiquitin. Cell lysates (input) were also probed to detect total protein levels. (H and I) AR ubiquitination assays using lysates of neurons infected with AAV2 GFP or AAV2 UBE3A virus for 10 days (H). Increased intensity of ubiquitination signals on AR was detected (I). n = 3 independent experiments. (J and K) AR was immunoprecipitated from brain lysates and probed for ubiquitin signals. An elevated level in AR ubiquitination was detected in Ube3A 2xTg mice compared to WT. n = 6 animals/group. Mean ± SEM. ∗ p < 0.05; ∗∗ p < 0.01. ns, not significant. In (C), (D), and (F) two-way ANOVA with Bonferroni’s multiple comparisons test; In (B), (I), and (K) Unpaired two-tailed t test.

    Journal: iScience

    Article Title: Role of androgen receptors in sexually dimorphic phenotypes in UBE3A-dependent autism spectrum disorder

    doi: 10.1016/j.isci.2025.111868

    Figure Lengend Snippet: UBE3A overexpression can independently induce AR reduction by increasing ubiquitination and degradation of AR (A) Representative images of immunocytochemistry for AR (red) at DIV 8 in rat cortical neuron cultures after transfected with GFP alone or together with UBE3A at DIV4. Scale bars, 25 μm. (B) UBE3A overexpression reduced AR intensity in primary culture neurons. GFP: n = 22, GFP+UBE3A: n = 19. (C and D) AR mRNA expression detected by qPCR was not altered in Tg males and Tg females at postnatal day 0 (C) and postnatal day 21 (D) in prefrontal cortex. P0: n = 7 animals/group; P21: n = 7 animals/group. (E) Degradation assay of AR with or without UBE3A. Transfected HEK cells were treated with cycloheximide (CHX) for various time points and cell lysates were collected to examine AR levels by western blot. (F) Quantification of the degradation rate of AR over time; n = 4 independent experiments. (G) AR ubiquitination assay. HEK293T cells were transfected with AR, HA-ubiquitin (Ubi), and either a vector control, UBE3A, or the E3 ligase dead mutant UBE3A C820A for 2 days. AR was immunoprecipitated and probed for ubiquitin. Cell lysates (input) were also probed to detect total protein levels. (H and I) AR ubiquitination assays using lysates of neurons infected with AAV2 GFP or AAV2 UBE3A virus for 10 days (H). Increased intensity of ubiquitination signals on AR was detected (I). n = 3 independent experiments. (J and K) AR was immunoprecipitated from brain lysates and probed for ubiquitin signals. An elevated level in AR ubiquitination was detected in Ube3A 2xTg mice compared to WT. n = 6 animals/group. Mean ± SEM. ∗ p < 0.05; ∗∗ p < 0.01. ns, not significant. In (C), (D), and (F) two-way ANOVA with Bonferroni’s multiple comparisons test; In (B), (I), and (K) Unpaired two-tailed t test.

    Article Snippet: p6898 PHAGE-P CMVT N-HA-hE6AP I C820A (UBE3A-C820A) , Addgene , Cat# 37602; RRID:Addgene_37602.

    Techniques: Over Expression, Ubiquitin Proteomics, Immunocytochemistry, Transfection, Expressing, Degradation Assay, Western Blot, Plasmid Preparation, Control, Mutagenesis, Immunoprecipitation, Infection, Virus, Two Tailed Test

    Journal: iScience

    Article Title: Role of androgen receptors in sexually dimorphic phenotypes in UBE3A-dependent autism spectrum disorder

    doi: 10.1016/j.isci.2025.111868

    Figure Lengend Snippet:

    Article Snippet: p6898 PHAGE-P CMVT N-HA-hE6AP I C820A (UBE3A-C820A) , Addgene , Cat# 37602; RRID:Addgene_37602.

    Techniques: Virus, Recombinant, Protease Inhibitor, cDNA Synthesis, Bicinchoninic Acid Protein Assay, Software

    VMHvl Tac1 neurons drive attack behavior and are the site where increased Ube3a gene dosage modeling a genetic ASD heightens aggression. (A) Representative images and traces of calcium events in three VMHvl Tac1 neurons expressing GCaMP7 recorded using Inscopix miniature microscope with implanted GRIN lens when the resident male in its home- cage is exposed to a male intruder (resident-intruder paradigm). (B) Left: diagram of stereotactic injections of AAV virus in Tac1-Cre ( Tac1 tm1.1(cre)Hze ) or Pgr-Cre ( Pgr tm1.1(cre)Shah ) mice. Right: upper panel: total attack time/number in Tac1-Cre mice ( n =7) injected with AAV-DIO- hM3D(Gq)-RFP, comparing application of saline and CNO (1 mg/kg i.p.). P value of total attack time ( P T ) = 0.0068, and P value of attack number ( P N ) = 0.0042. Lower panel: total attack time/number in Pgr-Cre mice ( n =7) injected with AAV-DIO-hM3D(Gq)-RFP, comparing application of saline and CNO (1 mg/kg i.p., P T = 0.0038, P N = 0.0165). ( C-E ) Total attack time and attack number in C, VGluT2-Cre ( Slc17a6 tm2(cre)Lowl ): LoxTB-Ube3a-2x mice ( n = 14) comparing LoxTB-Ube3a-2x littermates ( n = 9) ( P T = 0.026, P N = 0.042); D , Vgat -Cre ( Slc32a1 tm2(cre)Lowl ) :LoxTB-Ube3a-2x mice ( n =14) and LoxTB-Ube3a-2x littermates ( n = 12) ( P T = 0.9007, P N = 0.8203); E , Sf1-Cre (Tg(Nr5a1-cre)7Lowl): LoxTB-Ube3a-2x mice ( n = 14) and LoxTB-Ube3a-2x littermates ( n = 14) ( PT = 0.0056, P N = 0.0085). Below, anti-FLAG antibody immunofluorescence in ventromedial hypothalamus (VMH), scale bars 200 μm. ( F ) Left: upper panel: diagram of construct of AAV-hSyn-DIO-Ube3a and stereotactic injections. Lower panel: representative image of anti-GFP antibody immunofluorescence in VGluT2 -Cre mice injected with AAV-hSyn-DIO-Ube3a and AAV-hSyn-DIO-GFP in VMHvl, scale bar, 50 μm. Right: total attack time/number in VGluT2 -Cre mice injected with AAV-hSyn-DIO- Ube3a:AAV-DIO-GFP ( n = 16), compared to wild type littermates with AAV-CMV-GFP ( n = 11, P T = 0.0373, P N = 0.0394) in VMHvl. ( G ) Left: diagram of construct of Cre-inactivate-able Ube3a BAC Transgenic ( Ube3a OFF#5; figS2I, a conditional Ube3a transgene where LoxP site flank exons of the full-length untagged Ube3a gene) and stereotactic injections. Right: total attack time/number in Ube3a OFF#5 mice injected with AAV-CMV-CreGFP ( n = 25) in VMHvl compared to AAV-CMV-GFP ( n = 18, P T = 0.0146, P N = 0.0385). ( H ) Left: diagram of construct of AAV-hSyn-DIO-Ube3a, stereotactic injections. Middle: representative image of anti-GFP antibody immunofluorescence staining in Tac1 Cre mice injected with AAV-hSyn-DIO- Ube3a and AAV-hSyn-DIO-GFP in VMHvl (scale bar, 50 μm). Right: total attack time/number in Tac1-Cre mice injected with AAV-hSyn-DIO-Ube3a:AAV-DIO-GFP ( n = 11) in VMHvl, compared to wild type littermates injected with AAV-CMV-GFP ( n = 16, P T = 0.025, P N = 0.0443). ( I ) Total attack time/number in Pgr-Cre mice injected with AAV-hSyn-DIO- Ube3a:AAV-DIO-GFP ( n = 17) in VMHvl, compared to wild type littermates injected with AAV-CMV-GFP ( n = 10, P T = 0.026, P N = 0.032). ( J ) Total attack time/number in wild type ( n = 23) mice, comparing with Ube3a-1x ( n = 10, P T = ns, P N =ns); with Ube3a-NLS3-1x mice ( n = 12, P T < 0.0001, P N < 0.0001); and with Ube3a-NLS7-1x mice ( n = 8, P T < 0.0001, P N < 0.0001). ( K ) Total attack time/number in Tac1-Cre mice injected with AAV-DIO-GFP + AAV-DIO- Ube3a-NLS ( n =11) in VMHvl, compared to AAV-DIO-GFP ( n = 11) ( P T =0.0130, P N =0.0183). ( L ) Calcium events in VMHvl Tac1 neurons recorded using Inscopix miniature microscope, compared Tac1-Cre mice injected with AAV9-hSyn-DIO-GCaMP7f ( n = 7 cells) to AAV-DIO- Ube3a-NLS:AAV9-hSyn-DIO-GCaMP7f ( n = 17 cells, P =0.0261; unpaired T-test with Welch’s correction). Unpaired two-tailed Student’s t-test was used to determine statistical significance when comparing two groups. Comparisons across two groups before and after CNO treatment analyzed by paired two-tailed Student’s t-test. Multiple groups were analyzed using 1-way ANOVA followed by Bonferroni’s Multiple Comparison Correction. Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: VMHvl Tac1 neurons drive attack behavior and are the site where increased Ube3a gene dosage modeling a genetic ASD heightens aggression. (A) Representative images and traces of calcium events in three VMHvl Tac1 neurons expressing GCaMP7 recorded using Inscopix miniature microscope with implanted GRIN lens when the resident male in its home- cage is exposed to a male intruder (resident-intruder paradigm). (B) Left: diagram of stereotactic injections of AAV virus in Tac1-Cre ( Tac1 tm1.1(cre)Hze ) or Pgr-Cre ( Pgr tm1.1(cre)Shah ) mice. Right: upper panel: total attack time/number in Tac1-Cre mice ( n =7) injected with AAV-DIO- hM3D(Gq)-RFP, comparing application of saline and CNO (1 mg/kg i.p.). P value of total attack time ( P T ) = 0.0068, and P value of attack number ( P N ) = 0.0042. Lower panel: total attack time/number in Pgr-Cre mice ( n =7) injected with AAV-DIO-hM3D(Gq)-RFP, comparing application of saline and CNO (1 mg/kg i.p., P T = 0.0038, P N = 0.0165). ( C-E ) Total attack time and attack number in C, VGluT2-Cre ( Slc17a6 tm2(cre)Lowl ): LoxTB-Ube3a-2x mice ( n = 14) comparing LoxTB-Ube3a-2x littermates ( n = 9) ( P T = 0.026, P N = 0.042); D , Vgat -Cre ( Slc32a1 tm2(cre)Lowl ) :LoxTB-Ube3a-2x mice ( n =14) and LoxTB-Ube3a-2x littermates ( n = 12) ( P T = 0.9007, P N = 0.8203); E , Sf1-Cre (Tg(Nr5a1-cre)7Lowl): LoxTB-Ube3a-2x mice ( n = 14) and LoxTB-Ube3a-2x littermates ( n = 14) ( PT = 0.0056, P N = 0.0085). Below, anti-FLAG antibody immunofluorescence in ventromedial hypothalamus (VMH), scale bars 200 μm. ( F ) Left: upper panel: diagram of construct of AAV-hSyn-DIO-Ube3a and stereotactic injections. Lower panel: representative image of anti-GFP antibody immunofluorescence in VGluT2 -Cre mice injected with AAV-hSyn-DIO-Ube3a and AAV-hSyn-DIO-GFP in VMHvl, scale bar, 50 μm. Right: total attack time/number in VGluT2 -Cre mice injected with AAV-hSyn-DIO- Ube3a:AAV-DIO-GFP ( n = 16), compared to wild type littermates with AAV-CMV-GFP ( n = 11, P T = 0.0373, P N = 0.0394) in VMHvl. ( G ) Left: diagram of construct of Cre-inactivate-able Ube3a BAC Transgenic ( Ube3a OFF#5; figS2I, a conditional Ube3a transgene where LoxP site flank exons of the full-length untagged Ube3a gene) and stereotactic injections. Right: total attack time/number in Ube3a OFF#5 mice injected with AAV-CMV-CreGFP ( n = 25) in VMHvl compared to AAV-CMV-GFP ( n = 18, P T = 0.0146, P N = 0.0385). ( H ) Left: diagram of construct of AAV-hSyn-DIO-Ube3a, stereotactic injections. Middle: representative image of anti-GFP antibody immunofluorescence staining in Tac1 Cre mice injected with AAV-hSyn-DIO- Ube3a and AAV-hSyn-DIO-GFP in VMHvl (scale bar, 50 μm). Right: total attack time/number in Tac1-Cre mice injected with AAV-hSyn-DIO-Ube3a:AAV-DIO-GFP ( n = 11) in VMHvl, compared to wild type littermates injected with AAV-CMV-GFP ( n = 16, P T = 0.025, P N = 0.0443). ( I ) Total attack time/number in Pgr-Cre mice injected with AAV-hSyn-DIO- Ube3a:AAV-DIO-GFP ( n = 17) in VMHvl, compared to wild type littermates injected with AAV-CMV-GFP ( n = 10, P T = 0.026, P N = 0.032). ( J ) Total attack time/number in wild type ( n = 23) mice, comparing with Ube3a-1x ( n = 10, P T = ns, P N =ns); with Ube3a-NLS3-1x mice ( n = 12, P T < 0.0001, P N < 0.0001); and with Ube3a-NLS7-1x mice ( n = 8, P T < 0.0001, P N < 0.0001). ( K ) Total attack time/number in Tac1-Cre mice injected with AAV-DIO-GFP + AAV-DIO- Ube3a-NLS ( n =11) in VMHvl, compared to AAV-DIO-GFP ( n = 11) ( P T =0.0130, P N =0.0183). ( L ) Calcium events in VMHvl Tac1 neurons recorded using Inscopix miniature microscope, compared Tac1-Cre mice injected with AAV9-hSyn-DIO-GCaMP7f ( n = 7 cells) to AAV-DIO- Ube3a-NLS:AAV9-hSyn-DIO-GCaMP7f ( n = 17 cells, P =0.0261; unpaired T-test with Welch’s correction). Unpaired two-tailed Student’s t-test was used to determine statistical significance when comparing two groups. Comparisons across two groups before and after CNO treatment analyzed by paired two-tailed Student’s t-test. Multiple groups were analyzed using 1-way ANOVA followed by Bonferroni’s Multiple Comparison Correction. Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Expressing, Microscopy, Virus, Injection, Saline, Immunofluorescence, Construct, Transgenic Assay, Staining, Two Tailed Test, Comparison

    Ube3a genetic and molecular constructs. (A ) Diagram of chromosome abnormality of maternal 15q11-13 interstitial duplication, maternal extranumerary isodicentric chromosome 15 (idic 15) and Angelman syndrome. ( B ) Diagram of construct of Ube3a 3xFlag transgenic mice with extra gene copies of full-length Ube3a gene. ( C ) Diagram of Ube3aNLS with 3xFLAG and nuclear localization signal (NLS) followed by a STOP codon added in frame to exon 12 of mouse Ube3a gene. ( D ) Photos of injured mice from cages with Ube3a-2x male mice. ( E ) Total attack time/number in wild type ( n =23) and Ube3a-2x mice ( n = 9, P T = 0.0007 and P N = 0.0003). ( F ) Diagram of LoxTB-Ube3a construct with transcriptional/translational stop cassette (red) containing an En2 splice acceptor (grey) followed by polyA tails (black), all flanked by LoxP sites and inserted into intron 1 of full-length FLAG- tagged Ube3a gene designed to block all potential splice isoforms. ( G ) Upper panel: total attack time/number in LoxTB-Ube3a-2x mice ( n = 20) comparing to ePet-Cre (Tg(Fev-cre)1Esd): LoxTB- Ube3a-2x mice ( n = 9) ( P T = 0.7520, P N = 0.9340). Lower panel: FLAG immunofluorescence in dorsal raphe, scale bar 100 μm. ( H ) Diagram of construct of AAV-hSyn-DIO-Ube3a that expresses Ube3a in a Cre-dependent manner. ( I ) Diagram of construct of Ube3a OFF#5, a conditional Ube3a transgene where LoxP site flank exons of the full-length untagged Ube3a gene. P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: Ube3a genetic and molecular constructs. (A ) Diagram of chromosome abnormality of maternal 15q11-13 interstitial duplication, maternal extranumerary isodicentric chromosome 15 (idic 15) and Angelman syndrome. ( B ) Diagram of construct of Ube3a 3xFlag transgenic mice with extra gene copies of full-length Ube3a gene. ( C ) Diagram of Ube3aNLS with 3xFLAG and nuclear localization signal (NLS) followed by a STOP codon added in frame to exon 12 of mouse Ube3a gene. ( D ) Photos of injured mice from cages with Ube3a-2x male mice. ( E ) Total attack time/number in wild type ( n =23) and Ube3a-2x mice ( n = 9, P T = 0.0007 and P N = 0.0003). ( F ) Diagram of LoxTB-Ube3a construct with transcriptional/translational stop cassette (red) containing an En2 splice acceptor (grey) followed by polyA tails (black), all flanked by LoxP sites and inserted into intron 1 of full-length FLAG- tagged Ube3a gene designed to block all potential splice isoforms. ( G ) Upper panel: total attack time/number in LoxTB-Ube3a-2x mice ( n = 20) comparing to ePet-Cre (Tg(Fev-cre)1Esd): LoxTB- Ube3a-2x mice ( n = 9) ( P T = 0.7520, P N = 0.9340). Lower panel: FLAG immunofluorescence in dorsal raphe, scale bar 100 μm. ( H ) Diagram of construct of AAV-hSyn-DIO-Ube3a that expresses Ube3a in a Cre-dependent manner. ( I ) Diagram of construct of Ube3a OFF#5, a conditional Ube3a transgene where LoxP site flank exons of the full-length untagged Ube3a gene. P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Construct, Transgenic Assay, Blocking Assay, Immunofluorescence

    Aggression is increased by nuclear-targeted UBE3A expression in VMHvl Tac1-Cre neurons but not in VMHdm of Sf1-Cre neurons. ( A ) Diagram of stereotaxic injection. ( B ) Representative image of GFP expression in VMHvl Tac1 neurons when stereotactically injecting AAV-DIO-Ube3a-NLS + AAV-DIO-GFP virus into VMHvl of Tac1-Cre male mice (scale bar, 100 μm). ( C ) Left: representative photo of female mouse with hind injury. Right: number of male mice that injured female added to their cages in Tac1-Cre mice injected with AAV-DIO-GFP + AAV-DIO-Ube3aNLS ( n = 11 mice) compared to AAV-DIO-GFP ( n = 11 mice) in VMHvl ( P = 0.032). ( D ) Diagram of stereotaxic injection. ( E ) Representative image of GFP expression in VMH Sf1 neurons when stereotactically injecting AAV-DIO-Ube3a-NLS+ AAV-DIO-GFP virus into VMHdm of Sf1-Cre male mice (scale bar, 100 μm). ( F ) Total attack time/number in Sf1-Cre male mice compared stereotactically injecting AAV-DIO-Ube3a-NLS+ AAV-DIO-GFP virus ( n = 14) into VMHdm of Sf1-Cre male mice with only AAV-DIO-GFP ( n = 10, P T = 0.2002, P N = 0.2460). ( G ) Combined data of quantitative RT-qPCR of Cbln1 and Syn1 mRNA from single neurons isolated from VMHvl in Sf1-Cre : Cbln1 flx/flx ( n = 24 neurons, green bar) comparing to Cbln1 flx/flx ( n = 28 neurons, black bar) ( P = 0.0003). P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: Aggression is increased by nuclear-targeted UBE3A expression in VMHvl Tac1-Cre neurons but not in VMHdm of Sf1-Cre neurons. ( A ) Diagram of stereotaxic injection. ( B ) Representative image of GFP expression in VMHvl Tac1 neurons when stereotactically injecting AAV-DIO-Ube3a-NLS + AAV-DIO-GFP virus into VMHvl of Tac1-Cre male mice (scale bar, 100 μm). ( C ) Left: representative photo of female mouse with hind injury. Right: number of male mice that injured female added to their cages in Tac1-Cre mice injected with AAV-DIO-GFP + AAV-DIO-Ube3aNLS ( n = 11 mice) compared to AAV-DIO-GFP ( n = 11 mice) in VMHvl ( P = 0.032). ( D ) Diagram of stereotaxic injection. ( E ) Representative image of GFP expression in VMH Sf1 neurons when stereotactically injecting AAV-DIO-Ube3a-NLS+ AAV-DIO-GFP virus into VMHdm of Sf1-Cre male mice (scale bar, 100 μm). ( F ) Total attack time/number in Sf1-Cre male mice compared stereotactically injecting AAV-DIO-Ube3a-NLS+ AAV-DIO-GFP virus ( n = 14) into VMHdm of Sf1-Cre male mice with only AAV-DIO-GFP ( n = 10, P T = 0.2002, P N = 0.2460). ( G ) Combined data of quantitative RT-qPCR of Cbln1 and Syn1 mRNA from single neurons isolated from VMHvl in Sf1-Cre : Cbln1 flx/flx ( n = 24 neurons, green bar) comparing to Cbln1 flx/flx ( n = 28 neurons, black bar) ( P = 0.0003). P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Expressing, Injection, Virus, Quantitative RT-PCR, Isolation

    UBE3A represses Cbln1 gene expression and synergizes with a loss of NRXN1- CBLN1-GRID1 transsynaptic complex members to promote aggression. (A) Quantitative RT-PCR of Cbln1 mRNA in VMH in wild type littermate ( n = 6), and Ube3a-NLS-1x transgenic mice ( n = 6, P = 0.0317). (B) Cbln1 5’ promoter sequence (1.3 kb) driving luciferase reporter with co-transfected Ube3a ( n = 6), comparing to mock plasmid ( n = 6, P < 0.0001). Diagram shows the luciferase reporter construct. (C) The ratio of Cbln1 promoter DNA immunoprecipitated from cortex samples, relative to input chromatin, compared anti-UBE3A antibody to “Mock” rabbit IgG ( n = 3, P = 0.015). Diagram shows FAM/ZEN probe location. ( D ) Total attack time/number in mice with Sf1 - Cre : Cbln1 flx/flx ( n = 26) compared to Cbln1 flx/flx littermates ( n = 18, P T = 0.0098, P N = 0.0180). ( E ) Total attack time/number in Cbln1 flx/flx mice with injected AAV-CMV-CreGFP ( n = 23) vs. AAV-CMV-GFP ( n =16) in VMHvl ( P T = 0.0418, P N = 0.0413). ( F ) Total attack time/number in mice with Tac1-Cre / Cbln1 flx/flx ( n = 17) compared to Cbln1 flx/flx littermates ( n = 13, P T = 0.0285, P N = 0.0313). ( G ) Total attack time/number in Tac1-Cre mice injected with AAV-DIO-Ube3a-NLS ( n = 10), comparing with AAV-DIO-Cbln1 + AAV-DIO-Ube3aNLS ( n = 14, P T = 0.030, P N = 0.0245) in VMHvl. ( H ) Diagram of protein physical interactions between CBLN1, NRXN1, and GRID1. ( I ) Number of ASD cases with genomic copy number variations (CNVs) encompassing genes UBE3A, NRXN1 and GRID1 including duplications/triplications (Dup) and deletions (Del). ( J ) Total attack time/number in wild type littermates (n=4), Nrxn1 heterozygous ( n = 12, P T = ns, P N = ns) and Nrxn1 homozygous deletion mice ( n = 5, P T = 0.009, P N = 0.006). ( K ) Total attack time/number in mice with Ube3a-1x ( n = 14), compared to Ube3a-1x and Nrxn1 +/- (n = 20, P T = 0.0261, P N = 0.0257). ( L ) Total attack time/number in wild type littermates ( n = 12), Grid1 heterozygous ( n = 22) and Grid1 homozygous deletion mice ( n = 16, P T = 0.0023, P N = 0.0018). ( M ) Total attack time/number in mice with Ube3a-1x ( n = 20), compared to Ube3a-1x and Grid1 +/- ( n = 20, P T = 0.012, P N = 0.0085). An unpaired two-tailed Student’s t-test was used to determine statistical significance when comparing two groups. Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01, *** P < 0.001.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: UBE3A represses Cbln1 gene expression and synergizes with a loss of NRXN1- CBLN1-GRID1 transsynaptic complex members to promote aggression. (A) Quantitative RT-PCR of Cbln1 mRNA in VMH in wild type littermate ( n = 6), and Ube3a-NLS-1x transgenic mice ( n = 6, P = 0.0317). (B) Cbln1 5’ promoter sequence (1.3 kb) driving luciferase reporter with co-transfected Ube3a ( n = 6), comparing to mock plasmid ( n = 6, P < 0.0001). Diagram shows the luciferase reporter construct. (C) The ratio of Cbln1 promoter DNA immunoprecipitated from cortex samples, relative to input chromatin, compared anti-UBE3A antibody to “Mock” rabbit IgG ( n = 3, P = 0.015). Diagram shows FAM/ZEN probe location. ( D ) Total attack time/number in mice with Sf1 - Cre : Cbln1 flx/flx ( n = 26) compared to Cbln1 flx/flx littermates ( n = 18, P T = 0.0098, P N = 0.0180). ( E ) Total attack time/number in Cbln1 flx/flx mice with injected AAV-CMV-CreGFP ( n = 23) vs. AAV-CMV-GFP ( n =16) in VMHvl ( P T = 0.0418, P N = 0.0413). ( F ) Total attack time/number in mice with Tac1-Cre / Cbln1 flx/flx ( n = 17) compared to Cbln1 flx/flx littermates ( n = 13, P T = 0.0285, P N = 0.0313). ( G ) Total attack time/number in Tac1-Cre mice injected with AAV-DIO-Ube3a-NLS ( n = 10), comparing with AAV-DIO-Cbln1 + AAV-DIO-Ube3aNLS ( n = 14, P T = 0.030, P N = 0.0245) in VMHvl. ( H ) Diagram of protein physical interactions between CBLN1, NRXN1, and GRID1. ( I ) Number of ASD cases with genomic copy number variations (CNVs) encompassing genes UBE3A, NRXN1 and GRID1 including duplications/triplications (Dup) and deletions (Del). ( J ) Total attack time/number in wild type littermates (n=4), Nrxn1 heterozygous ( n = 12, P T = ns, P N = ns) and Nrxn1 homozygous deletion mice ( n = 5, P T = 0.009, P N = 0.006). ( K ) Total attack time/number in mice with Ube3a-1x ( n = 14), compared to Ube3a-1x and Nrxn1 +/- (n = 20, P T = 0.0261, P N = 0.0257). ( L ) Total attack time/number in wild type littermates ( n = 12), Grid1 heterozygous ( n = 22) and Grid1 homozygous deletion mice ( n = 16, P T = 0.0023, P N = 0.0018). ( M ) Total attack time/number in mice with Ube3a-1x ( n = 20), compared to Ube3a-1x and Grid1 +/- ( n = 20, P T = 0.012, P N = 0.0085). An unpaired two-tailed Student’s t-test was used to determine statistical significance when comparing two groups. Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01, *** P < 0.001.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Gene Expression, Quantitative RT-PCR, Transgenic Assay, Sequencing, Luciferase, Transfection, Plasmid Preparation, Construct, Immunoprecipitation, Injection, Two Tailed Test

    Images of anti-c-fos staining and quantification of c-fos positive neurons after aggression behavior test comparing Ube3a-2x with littermate control mice. ( A ) Total attack time/number in aggression behavior test compared Ube3a-2x (n = 3) and littermate control mice (n = 3, P T = 0.0035, P N = 0.0133). ( B ) and ( C ) Counts of c-fos positive neurons in ventral premamillary (PMv) ( B , P = 0.3731) and full VMHvl ( C , P = 0.3167) after aggression behavior test compared Ube3a-2x compared to control littermate mice. ( D ) Representative image of anti-c-fos antibody staining in dorsal raphe compared Ube3a-2x and control littermate mice (scale bar, 100 microns). ( E ) Counts of c-fos positive neurons in dorsal raphe ( P = 0.0217) after aggression behavior testing comparing Ube3a-2x and control littermate mice. ( F ) Representative image of anti-c-fos antibody staining in MEA compared Ube3a-2x and control littermate mice (scale bar, 100 microns). ( G ) Counts of c-fos positive neurons in MEA ( P = 0.1150) after aggression behavior test. All c-fos studies compared male Ube3a-2x ( n = 3 mice) and control littermate mice ( n = 3 mice). P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: Images of anti-c-fos staining and quantification of c-fos positive neurons after aggression behavior test comparing Ube3a-2x with littermate control mice. ( A ) Total attack time/number in aggression behavior test compared Ube3a-2x (n = 3) and littermate control mice (n = 3, P T = 0.0035, P N = 0.0133). ( B ) and ( C ) Counts of c-fos positive neurons in ventral premamillary (PMv) ( B , P = 0.3731) and full VMHvl ( C , P = 0.3167) after aggression behavior test compared Ube3a-2x compared to control littermate mice. ( D ) Representative image of anti-c-fos antibody staining in dorsal raphe compared Ube3a-2x and control littermate mice (scale bar, 100 microns). ( E ) Counts of c-fos positive neurons in dorsal raphe ( P = 0.0217) after aggression behavior testing comparing Ube3a-2x and control littermate mice. ( F ) Representative image of anti-c-fos antibody staining in MEA compared Ube3a-2x and control littermate mice (scale bar, 100 microns). ( G ) Counts of c-fos positive neurons in MEA ( P = 0.1150) after aggression behavior test. All c-fos studies compared male Ube3a-2x ( n = 3 mice) and control littermate mice ( n = 3 mice). P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Staining, Control

    Loss of postsynaptic glutamate receptor delta subunit gene Grid1 in arcuate AgRP/NPY neurons impairs their glutamatergic synapses to increase aggression. (A) Representative image of anti-c-fos antibody immunofluorescence staining in PAG after aggression behavior test compared Ube3a-2x mice with their little mate control (scale bar, 100 μm). (B) Representative image of anti-c-fos staining in arcuate and VMHvl compared Ube3a-2x mice with control (scale bar, 100 μm). C, D, E, F, Quantitatively counting c-fos positive neurons in PAG (C, P = 0.0396); BNST (D, P = 0.4578); arcuate (E, P = 0.0249) and a selection of region of VMHvl ( F , P = 0.0472) after aggression behavior test compared Ube3a-2x mice with their littermate control. ( G ) In situ hybridization of parasagittal VMH-arcuate hypothalamus sections probed for Nrxn1 , Cbln1 , and Grid1 mRNA (adapted from Allen Mouse Brain Atlas (2004)). ( H ) Total attack time/number in mice with Vglut2-Cre : Grid1 flx/flx ( n = 16) compared to Grid1 flx/flx littermates ( n = 23, P T = 0.2612, P N = 0.3579). ( I ) Total attack time/number in mice with Vgat-Cre : Grid1 flx/flx ( n = 13) compared to Grid1 flx/flx littermates ( n = 16, P T = 0.7061, P N = 0.7208). ( J ) Total attack time/number in mice with Pomc-Cre (Tg(Pomc1-cre)16Lowl): Grid1 flx/flx ( n = 19) compared to Grid1 flx/flx littermates ( n = 17, P T = 0.1682, P N = 0.0753). ( K ) Total attack time/number in mice with Agrp-Cre ( Agrp tm1(cre)Lowl ): Grid1 flx/flx ( n = 12) compared to Grid1 flx/flx littermates ( n = 9, P T = 0.0067, P N = 0.0498). ( L ) Diagram of stereotactic injections. ( M ) Total attack time/number in Pomc-Cre mice injected with AAV-TATAlox-Grid1-shRNA ( n = 11) in arcuate, comparing to WT mice injected with AAV-TATAlox-Grid1-shRNA ( n = 17, P T = 0.3212, P N = 0.272). ( N ) Total attack time/number in Agrp-Cre mice injected with AAV-TATAlox-Grid1-shRNA ( n = 32) in arcuate, comparing to mice injected with AAV-TATAlox-scrambled-shRNA ( n = 20, P T = 0.0403, P N = 0.0360). ( O ) Cumulative frequency plot of miniature excitatory post-synaptic current (mEPSC) inter-event intervals in arcuate NPY GFP + neurons in mice with homozygous deletion Grid1 ( n = 4 mice, 16 cells) and control mice ( n = 5 mice, 14 cells), Kolmogorov-Smirnov (KS) test, P < 0.00001. ( P ) Cumulative frequency plot of miniature excitatory post-synaptic current (mEPSC) inter-event intervals in arcuate NPY GFP + neurons (labeled by Npy-hrGFP allele; B6.FVB-Tg(Npy-hrGFP)1Lowl/J) in mice with Grid1 knockout ( Agrp-Cre : Grid1 flx/flx ) in arcuate Agrp/NPY neurons ( n = 6 mice, 11 neurons) compared to control wild type mice ( n = 4 mice, 14 cells,). ( Q ) Cumulative frequency plot of miniature excitatory post-synaptic current (mEPSC) inter-event intervals in arcuate NPY GFP + neurons (labeled by Npy-hrGFP allele) in mice with Grid1 knockdown (AAV-hSyn-TATAlox-Grid1-shRNA vs. scrambled) in arcuate Agrp/NPY neurons ( n = 3 mice, 6 neurons) compared to control wild type mice ( n = 6 mice, 18 cells). An unpaired two-tailed Student’s t-test was used to determine statistical significance when comparing two groups. Multiple groups (Fig. -F ) are analyzed using repeated two-way ANOVA with Multiple Comparison. mEPSC inter-event intervals and amplitude are analyzed using Kolmogorov-Smirnov (KS) test. Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. See also and S6.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: Loss of postsynaptic glutamate receptor delta subunit gene Grid1 in arcuate AgRP/NPY neurons impairs their glutamatergic synapses to increase aggression. (A) Representative image of anti-c-fos antibody immunofluorescence staining in PAG after aggression behavior test compared Ube3a-2x mice with their little mate control (scale bar, 100 μm). (B) Representative image of anti-c-fos staining in arcuate and VMHvl compared Ube3a-2x mice with control (scale bar, 100 μm). C, D, E, F, Quantitatively counting c-fos positive neurons in PAG (C, P = 0.0396); BNST (D, P = 0.4578); arcuate (E, P = 0.0249) and a selection of region of VMHvl ( F , P = 0.0472) after aggression behavior test compared Ube3a-2x mice with their littermate control. ( G ) In situ hybridization of parasagittal VMH-arcuate hypothalamus sections probed for Nrxn1 , Cbln1 , and Grid1 mRNA (adapted from Allen Mouse Brain Atlas (2004)). ( H ) Total attack time/number in mice with Vglut2-Cre : Grid1 flx/flx ( n = 16) compared to Grid1 flx/flx littermates ( n = 23, P T = 0.2612, P N = 0.3579). ( I ) Total attack time/number in mice with Vgat-Cre : Grid1 flx/flx ( n = 13) compared to Grid1 flx/flx littermates ( n = 16, P T = 0.7061, P N = 0.7208). ( J ) Total attack time/number in mice with Pomc-Cre (Tg(Pomc1-cre)16Lowl): Grid1 flx/flx ( n = 19) compared to Grid1 flx/flx littermates ( n = 17, P T = 0.1682, P N = 0.0753). ( K ) Total attack time/number in mice with Agrp-Cre ( Agrp tm1(cre)Lowl ): Grid1 flx/flx ( n = 12) compared to Grid1 flx/flx littermates ( n = 9, P T = 0.0067, P N = 0.0498). ( L ) Diagram of stereotactic injections. ( M ) Total attack time/number in Pomc-Cre mice injected with AAV-TATAlox-Grid1-shRNA ( n = 11) in arcuate, comparing to WT mice injected with AAV-TATAlox-Grid1-shRNA ( n = 17, P T = 0.3212, P N = 0.272). ( N ) Total attack time/number in Agrp-Cre mice injected with AAV-TATAlox-Grid1-shRNA ( n = 32) in arcuate, comparing to mice injected with AAV-TATAlox-scrambled-shRNA ( n = 20, P T = 0.0403, P N = 0.0360). ( O ) Cumulative frequency plot of miniature excitatory post-synaptic current (mEPSC) inter-event intervals in arcuate NPY GFP + neurons in mice with homozygous deletion Grid1 ( n = 4 mice, 16 cells) and control mice ( n = 5 mice, 14 cells), Kolmogorov-Smirnov (KS) test, P < 0.00001. ( P ) Cumulative frequency plot of miniature excitatory post-synaptic current (mEPSC) inter-event intervals in arcuate NPY GFP + neurons (labeled by Npy-hrGFP allele; B6.FVB-Tg(Npy-hrGFP)1Lowl/J) in mice with Grid1 knockout ( Agrp-Cre : Grid1 flx/flx ) in arcuate Agrp/NPY neurons ( n = 6 mice, 11 neurons) compared to control wild type mice ( n = 4 mice, 14 cells,). ( Q ) Cumulative frequency plot of miniature excitatory post-synaptic current (mEPSC) inter-event intervals in arcuate NPY GFP + neurons (labeled by Npy-hrGFP allele) in mice with Grid1 knockdown (AAV-hSyn-TATAlox-Grid1-shRNA vs. scrambled) in arcuate Agrp/NPY neurons ( n = 3 mice, 6 neurons) compared to control wild type mice ( n = 6 mice, 18 cells). An unpaired two-tailed Student’s t-test was used to determine statistical significance when comparing two groups. Multiple groups (Fig. -F ) are analyzed using repeated two-way ANOVA with Multiple Comparison. mEPSC inter-event intervals and amplitude are analyzed using Kolmogorov-Smirnov (KS) test. Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. See also and S6.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Immunofluorescence, Staining, Control, Selection, In Situ Hybridization, Injection, shRNA, Labeling, Knock-Out, Knockdown, Two Tailed Test, Comparison

    NRXN1-CBLN1-GRID1 transsynaptic complex forms excitatory synapses from VMHvl to arcuate NPY/AgRP neurons which provide feedback inhibition to VMHvl that is augmented by aggression medication risperidone. (A) Left: diagram of stereotactic injections. Right: representative image of anti-DsRed antibody immunofluorescence staining in Agrp-Cre mice injected with AAV-DIO-hM4D(Gq)-RFP in arcuate (scale bar, 30 μm). (B) Total attack time/number in Agrp-Cre mice with AAV-DIO-hM4D(Gi)-RFP injected in arcuate, comparing application of saline with CNO (1 mg/kg i.p., n = 19, P T = 0.0016, P N = 0.001). (C) Total attack time/number in Agrp-Cre mice with AAV-DIO-hM3D(Gq)-RFP injected in arcuate, comparing application of saline with CNO (1 mg/kg i.p., n = 25, P T = 0.0035, P N = 0.0062). (D) Diagram of VMHvl-arcuate circuit with light-excitation of arcuate AgRP neuron axon terminals expressing ChR2. ( E ) Representative image of AgRP/NPY axons (green, Npy-hrGFP transgenic mice) surrounding VMHvl neurons (red, labelled by AAV-VGlut2-mCherry, scale bar 15 μm). ( F ) Representative trace of recorded VMHvl neuron hyperpolarized by light-stimulated arcuate AgRP/NPY neuron axons. ( G ) Amplitude of light-evoked hyperpolarization in VMHvl neurons with stimulation of arcuate neurons axons in control wild type mice ( n = 6 mice, 25 neurons, -4.40 ± 0.50 mV), or mice treated with risperidone ( n = 4 mice, 11 neurons, -8.29 ± 0.98 mV). P = 0.0030 for control vs. risperidone treatment. ( H ) Total attack time/number in Ube3a-2x mice with risperidone treatment (1 mg/kg i.p., n = 25) comparing to saline treatment (n = 24, P t = 0.0475, P N = 0.0291). ( I ) Diagram of VMHvl-arcuate circuit with light-excitation of VMHvl glutamatergic neuron axon terminals. ( J ) Left: Diagram of stereotactic injections; and a representative image showing that labeled AgRP/NPY neurons (green, Npy-hrGFP mice) are surrounded by ChR2- expressing axons from VMHvl glutamate neurons (red, scale bar 15 μm). Right: representative trace of light-evoked AMPA excitatory post-synaptic currents (EPSCs) recorded in arcuate NPY GFP + neurons by stimulating VMHvl terminals projecting to arcuate NPY neurons. ( K ) Amplitude of light-evoked EPSCs recorded in arcuate NPY GFP + neurons when stimulating VMHvl ChR2- expressing terminals projecting to arcuate NPY neurons in mice with homozygous Nrxn1 deletion ( n = 5 mice, 14 neurons), Grid1 deletion ( n = 6 mice, 11 cells), Cbln1 deletion in VMHvl ( (n = 4 mice, 13 neurons) or increased nuclear UBE3A (VGluT2-Cre mice with AAV-hSyn-DIO-Ube3a- NLS in VMHvl) ( n = 4 mice, 13 neurons); compared to control wild type mice ( n = 8 mice, 31 cells). The P value of one-way ANOVA is <0.0001; the P values of Bonferroni’s multiple comparisons test are: P = 0.0039 for Nrxn1 KO vs. WT; P = 0.0004 for Cbln1 KO vs. WT; P = 0.0047 for Grid1 KO vs. WT; P = 0.0012 for increasing nuclear UBE3A vs. WT. ( L ) Amplitude of light-evoked EPSCs recorded in arcuate NPY GFP + neurons by stimulating VMHvl terminals projecting to arcuate NPY neurons in mice injected with AAV-hSyn-DIO-Ube3a-NLS in VMHvl ( n = 4 mice, 13 neurons) compared to AAV-hSyn-DIO-Cbln1 + AAV-hSyn-DIO-Ube3aNLS ( n = 7 mice, n = 23 neurons, P = 0.0409). ( M ) Model where VMHvl neurons form excitatory glutamatergic synapses onto arcuate NPY/AgRP neurons, which provide feedback inhibition by hyperpolarizing VMHvl neurons, serving as a gate to limit aggression. Paired two-tailed Student’s t-test was used for comparisons across two groups before and after CNO treatment in panel B , C. Multiple groups (panel K ) are analyzed using one-way ANOVA with Bonferroni’s Multiple Comparison Correction. Unpaired two-tailed Student’s t-test was used to determine statistical significance of panel G , H , I . Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01, *** P <0.001.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: NRXN1-CBLN1-GRID1 transsynaptic complex forms excitatory synapses from VMHvl to arcuate NPY/AgRP neurons which provide feedback inhibition to VMHvl that is augmented by aggression medication risperidone. (A) Left: diagram of stereotactic injections. Right: representative image of anti-DsRed antibody immunofluorescence staining in Agrp-Cre mice injected with AAV-DIO-hM4D(Gq)-RFP in arcuate (scale bar, 30 μm). (B) Total attack time/number in Agrp-Cre mice with AAV-DIO-hM4D(Gi)-RFP injected in arcuate, comparing application of saline with CNO (1 mg/kg i.p., n = 19, P T = 0.0016, P N = 0.001). (C) Total attack time/number in Agrp-Cre mice with AAV-DIO-hM3D(Gq)-RFP injected in arcuate, comparing application of saline with CNO (1 mg/kg i.p., n = 25, P T = 0.0035, P N = 0.0062). (D) Diagram of VMHvl-arcuate circuit with light-excitation of arcuate AgRP neuron axon terminals expressing ChR2. ( E ) Representative image of AgRP/NPY axons (green, Npy-hrGFP transgenic mice) surrounding VMHvl neurons (red, labelled by AAV-VGlut2-mCherry, scale bar 15 μm). ( F ) Representative trace of recorded VMHvl neuron hyperpolarized by light-stimulated arcuate AgRP/NPY neuron axons. ( G ) Amplitude of light-evoked hyperpolarization in VMHvl neurons with stimulation of arcuate neurons axons in control wild type mice ( n = 6 mice, 25 neurons, -4.40 ± 0.50 mV), or mice treated with risperidone ( n = 4 mice, 11 neurons, -8.29 ± 0.98 mV). P = 0.0030 for control vs. risperidone treatment. ( H ) Total attack time/number in Ube3a-2x mice with risperidone treatment (1 mg/kg i.p., n = 25) comparing to saline treatment (n = 24, P t = 0.0475, P N = 0.0291). ( I ) Diagram of VMHvl-arcuate circuit with light-excitation of VMHvl glutamatergic neuron axon terminals. ( J ) Left: Diagram of stereotactic injections; and a representative image showing that labeled AgRP/NPY neurons (green, Npy-hrGFP mice) are surrounded by ChR2- expressing axons from VMHvl glutamate neurons (red, scale bar 15 μm). Right: representative trace of light-evoked AMPA excitatory post-synaptic currents (EPSCs) recorded in arcuate NPY GFP + neurons by stimulating VMHvl terminals projecting to arcuate NPY neurons. ( K ) Amplitude of light-evoked EPSCs recorded in arcuate NPY GFP + neurons when stimulating VMHvl ChR2- expressing terminals projecting to arcuate NPY neurons in mice with homozygous Nrxn1 deletion ( n = 5 mice, 14 neurons), Grid1 deletion ( n = 6 mice, 11 cells), Cbln1 deletion in VMHvl ( (n = 4 mice, 13 neurons) or increased nuclear UBE3A (VGluT2-Cre mice with AAV-hSyn-DIO-Ube3a- NLS in VMHvl) ( n = 4 mice, 13 neurons); compared to control wild type mice ( n = 8 mice, 31 cells). The P value of one-way ANOVA is <0.0001; the P values of Bonferroni’s multiple comparisons test are: P = 0.0039 for Nrxn1 KO vs. WT; P = 0.0004 for Cbln1 KO vs. WT; P = 0.0047 for Grid1 KO vs. WT; P = 0.0012 for increasing nuclear UBE3A vs. WT. ( L ) Amplitude of light-evoked EPSCs recorded in arcuate NPY GFP + neurons by stimulating VMHvl terminals projecting to arcuate NPY neurons in mice injected with AAV-hSyn-DIO-Ube3a-NLS in VMHvl ( n = 4 mice, 13 neurons) compared to AAV-hSyn-DIO-Cbln1 + AAV-hSyn-DIO-Ube3aNLS ( n = 7 mice, n = 23 neurons, P = 0.0409). ( M ) Model where VMHvl neurons form excitatory glutamatergic synapses onto arcuate NPY/AgRP neurons, which provide feedback inhibition by hyperpolarizing VMHvl neurons, serving as a gate to limit aggression. Paired two-tailed Student’s t-test was used for comparisons across two groups before and after CNO treatment in panel B , C. Multiple groups (panel K ) are analyzed using one-way ANOVA with Bonferroni’s Multiple Comparison Correction. Unpaired two-tailed Student’s t-test was used to determine statistical significance of panel G , H , I . Mean ± SEM shown, ns P > 0.05, * P < 0.05, ** P < 0.01, *** P <0.001.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Inhibition, Immunofluorescence, Staining, Injection, Saline, Expressing, Transgenic Assay, Control, Labeling, Two Tailed Test, Comparison

    Miniature excitatory postsynaptic current (mEPSC) inter-event intervals and amplitude in arcuate NPY-GFP neurons of mice with deletion of Nrxn1 , Cbln1 or Ube3aNLS7-1x . (A) Left: Cumulative frequency plot of mEPSC inter-event intervals in arcuate NPY GFP + neurons in mice with homozygous deletion of Nrxn1 ( n = 6 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.00001); Right: diagram of whole–cell patch-clamp recordings were performed in GFP-labeled arcuate NPY/AgRP neurons. ( B ) Cumulative frequency plot of mEPSC amplitude in arcuate NPY GFP + neurons (labeled by NPY-hrGFP allele) in mice with homozygous deletion of Nrxn1 ( n = 6 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P > 0.05). ( C ) mEPSC inter-event intervals in arcuate NPY GFP + neurons from Sf1-Cre : Cbln1-flx/flx mice ( n = 5 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.001). ( D ) Cumulative frequency plot of mEPSC amplitude in arcuate NPY GFP + neurons in mice with Sf1-Cre : Cbln1 flx/flx ( n = 5 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.001). ( E ) mEPSC inter-event intervals in arcuate NPY GFP + neurons in mice with Ube3a- NLS7 - 1x ( n = 5 mice, 17 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.00001). ( F ) Cumulative frequency plot of mEPSC amplitude in arcuate NPY GFP + neurons in mice with Ube3aNLS7-1x ( n = 5 mice, 17 cells) and control mice ( n = 5 mice, 14 cells, KS test, P > 0.05). ( G ) Diagram of injection of AAV-hSyn-DIO-ChR2- mCherry plus AAV-VGlut2-Cre-2A- mCherry into VMHvl and representative image of VMHvl neurons expressing mCherry. ( H ) Diagram of whole–cell patch-clamp recordings performed in mCherry-labeled VMHvl neuron and representative trace of light-evoked ChR2 currents recorded in a VMHvl neuron. ( I ) Diagram of AAV-hSyn-DIO-GFP plus AAV-VGlut2-mCherry injected into VMHvl of VGluT2-Cre mice and representative image of VMHvl glutamate neurons showing overlapping expression of GFP and mCherry. Statistical significance of inter-event intervals and amplitude of mEPSC was determined by Kolmogorov-Smirnov (KS) test. P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Journal: bioRxiv

    Article Title: UBE3A and transsynaptic complex NRXN1-CBLN1-GluD1 in a hypothalamic VMHvl-arcuate feedback circuit regulates aggression

    doi: 10.1101/2023.02.28.530462

    Figure Lengend Snippet: Miniature excitatory postsynaptic current (mEPSC) inter-event intervals and amplitude in arcuate NPY-GFP neurons of mice with deletion of Nrxn1 , Cbln1 or Ube3aNLS7-1x . (A) Left: Cumulative frequency plot of mEPSC inter-event intervals in arcuate NPY GFP + neurons in mice with homozygous deletion of Nrxn1 ( n = 6 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.00001); Right: diagram of whole–cell patch-clamp recordings were performed in GFP-labeled arcuate NPY/AgRP neurons. ( B ) Cumulative frequency plot of mEPSC amplitude in arcuate NPY GFP + neurons (labeled by NPY-hrGFP allele) in mice with homozygous deletion of Nrxn1 ( n = 6 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P > 0.05). ( C ) mEPSC inter-event intervals in arcuate NPY GFP + neurons from Sf1-Cre : Cbln1-flx/flx mice ( n = 5 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.001). ( D ) Cumulative frequency plot of mEPSC amplitude in arcuate NPY GFP + neurons in mice with Sf1-Cre : Cbln1 flx/flx ( n = 5 mice, 19 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.001). ( E ) mEPSC inter-event intervals in arcuate NPY GFP + neurons in mice with Ube3a- NLS7 - 1x ( n = 5 mice, 17 cells) and control mice ( n = 5 mice, 14 cells, KS test, P < 0.00001). ( F ) Cumulative frequency plot of mEPSC amplitude in arcuate NPY GFP + neurons in mice with Ube3aNLS7-1x ( n = 5 mice, 17 cells) and control mice ( n = 5 mice, 14 cells, KS test, P > 0.05). ( G ) Diagram of injection of AAV-hSyn-DIO-ChR2- mCherry plus AAV-VGlut2-Cre-2A- mCherry into VMHvl and representative image of VMHvl neurons expressing mCherry. ( H ) Diagram of whole–cell patch-clamp recordings performed in mCherry-labeled VMHvl neuron and representative trace of light-evoked ChR2 currents recorded in a VMHvl neuron. ( I ) Diagram of AAV-hSyn-DIO-GFP plus AAV-VGlut2-mCherry injected into VMHvl of VGluT2-Cre mice and representative image of VMHvl glutamate neurons showing overlapping expression of GFP and mCherry. Statistical significance of inter-event intervals and amplitude of mEPSC was determined by Kolmogorov-Smirnov (KS) test. P < 0.05 was considered statistically significant with ns indicating non-significant, * P <0.05, ** P < 0.01, *** P <0.001 and **** P <0.0001.

    Article Snippet: The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237).

    Techniques: Control, Patch Clamp, Labeling, Injection, Expressing

    HBx stabilizes HCV core protein by protecting it from ubiquitin-dependent proteasomal degradation. (A) HepG2 cells were transfected with HA-Core with or without HA-HBx for 48 h, treated with 50 μM cycloheximide (CHX) for the indicated times, and collected for Western blotting. The band intensity of HA-Core was quantified as described in the legend of <xref ref-type=Fig. 1A to determine the half-life ( t 1/2 ) of the HCV core protein ( n = 4). (B) Huh7D cells were transfected with the 1.2-mer WT replicon and then infected with HCV at an MOI of 10 for an additional 48 h. The t 1/2 value of the HCV core protein was determined as described above for panel A. (C) Huh7D-NTCP cells were coinfected with HBV at an MOI of 30 and HCV at an MOI of 10 for 48 h. The t 1/2 value of the HCV core protein was determined as described above for panel A. (D) HepG2 cells were transfected with HA-HBx, HA-Core, an E6AP expression plasmid, and HA-ubiquitin (HA-Ub) for 48 h. Total HA-Core proteins were immunoprecipitated with an anti-HCV core protein antibody and subjected to Western blotting using an anti-HA antibody to detect polyubiquitinated HA-Core. The input shows the levels of the indicated proteins in whole-cell lysates. (E) HepG2 cells were transfected with the indicated amounts of HA-HBx, HA-Core, scrambled (SC) shRNA, and E6AP shRNA for 48 h, and samples were collected for immunoprecipitation (IP), as described above for panel D. (F) Huh7D-NTCP cells were transfected with an empty vector, an E6AP expression plasmid, and HA-Ub for 24 h and then monoinfected with HCV or coinfected with HBV and HCV for 48 h as described above for panel C, and samples were collected for IP as described above for panel D. (G) Huh7D cells were transfected with an empty vector, the 1.2-mer WT replicon, an E6AP expression plasmid, and HA-Ub for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. (H) HepG2 cells were transfected with either HA-HBx or HA-Core, followed by Western blot analysis. (I) HepG2 cells were transfected with the indicated amounts of HA-HBx, HA-Core, and an E6AP expression plasmid for 48 h. (J) Huh7D cells were transfected with the 1.2-mer WT replicon and an E6AP expression plasmid for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. (K) Huh7D-NTCP cells were transfected with either an empty vector or an E6AP expression plasmid for 24 h and then either mock infected or infected with HBV at an MOI of 30 and/or HCV at an MOI of 10 for an additional 48 h. (L) HepG2 cells were transfected with the indicated amounts of HA-HBx and HA-Core for 44 h and then either mock treated or treated with 10 μM MG132 for an additional 4 h. (M) HepG2 cells were transfected with the 1.2-mer WT replicon and then infected with HCV as described above for panel J. For lanes 4 to 6, cells were either mock treated or treated with 10 μM MG132 for 4 h before harvest. " width="100%" height="100%">

    Journal: Microbiology Spectrum

    Article Title: Hepatitis B Virus X Protein Stimulates Hepatitis C Virus (HCV) Replication by Protecting HCV Core Protein from E6AP-Mediated Proteasomal Degradation

    doi: 10.1128/spectrum.01432-22

    Figure Lengend Snippet: HBx stabilizes HCV core protein by protecting it from ubiquitin-dependent proteasomal degradation. (A) HepG2 cells were transfected with HA-Core with or without HA-HBx for 48 h, treated with 50 μM cycloheximide (CHX) for the indicated times, and collected for Western blotting. The band intensity of HA-Core was quantified as described in the legend of Fig. 1A to determine the half-life ( t 1/2 ) of the HCV core protein ( n = 4). (B) Huh7D cells were transfected with the 1.2-mer WT replicon and then infected with HCV at an MOI of 10 for an additional 48 h. The t 1/2 value of the HCV core protein was determined as described above for panel A. (C) Huh7D-NTCP cells were coinfected with HBV at an MOI of 30 and HCV at an MOI of 10 for 48 h. The t 1/2 value of the HCV core protein was determined as described above for panel A. (D) HepG2 cells were transfected with HA-HBx, HA-Core, an E6AP expression plasmid, and HA-ubiquitin (HA-Ub) for 48 h. Total HA-Core proteins were immunoprecipitated with an anti-HCV core protein antibody and subjected to Western blotting using an anti-HA antibody to detect polyubiquitinated HA-Core. The input shows the levels of the indicated proteins in whole-cell lysates. (E) HepG2 cells were transfected with the indicated amounts of HA-HBx, HA-Core, scrambled (SC) shRNA, and E6AP shRNA for 48 h, and samples were collected for immunoprecipitation (IP), as described above for panel D. (F) Huh7D-NTCP cells were transfected with an empty vector, an E6AP expression plasmid, and HA-Ub for 24 h and then monoinfected with HCV or coinfected with HBV and HCV for 48 h as described above for panel C, and samples were collected for IP as described above for panel D. (G) Huh7D cells were transfected with an empty vector, the 1.2-mer WT replicon, an E6AP expression plasmid, and HA-Ub for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. (H) HepG2 cells were transfected with either HA-HBx or HA-Core, followed by Western blot analysis. (I) HepG2 cells were transfected with the indicated amounts of HA-HBx, HA-Core, and an E6AP expression plasmid for 48 h. (J) Huh7D cells were transfected with the 1.2-mer WT replicon and an E6AP expression plasmid for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. (K) Huh7D-NTCP cells were transfected with either an empty vector or an E6AP expression plasmid for 24 h and then either mock infected or infected with HBV at an MOI of 30 and/or HCV at an MOI of 10 for an additional 48 h. (L) HepG2 cells were transfected with the indicated amounts of HA-HBx and HA-Core for 44 h and then either mock treated or treated with 10 μM MG132 for an additional 4 h. (M) HepG2 cells were transfected with the 1.2-mer WT replicon and then infected with HCV as described above for panel J. For lanes 4 to 6, cells were either mock treated or treated with 10 μM MG132 for 4 h before harvest.

    Article Snippet: The E6AP expression plasmid pCMVT N-HA-hE6AP (catalog no. 37601), encoding full-length human HA-tagged E6AP, was purchased from Addgene.

    Techniques: Ubiquitin Proteomics, Transfection, Western Blot, Infection, Expressing, Plasmid Preparation, Immunoprecipitation, shRNA

    HBx upregulates HCV core protein levels by repressing E6AP expression via DNA methylation. (A) HepG2 cells were transfected with the indicated amounts of HA-Core and HA-HBx for 48 h. DNA methyltransferase (DNMT) activity in the cell extracts was determined ( n = 6). The levels of the indicated proteins were determined by Western blotting. (B) Methylation-specific PCR (MSP) was performed to determine whether the CpG sites within the E6AP promoter were unmethylated (U) or methylated (M) in cells prepared as described above for panel A. (C) Huh7D cells were transfected with the 1.2-mer WT replicon for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. DNMT activity in the cell extracts was determined ( n = 4). The levels of the indicated proteins were determined by Western blotting. (D) MSP was performed as described above for panel B with cells prepared as described above for panel C. (E) Huh7D-NTCP cells were either mock infected or infected with HBV at an MOI of 30 and/or HCV at an MOI of 10 for 48 h. The DNMT activity in the cell extracts was determined ( n = 4). (F) MSP was performed as described above for panel B with cells prepared as described above for panel E. (G) HepG2 cells were transfected with the indicated amounts of HA-Core and HA-HBx for 48 h. For lanes 4 to 6, cells were treated with 10 μM 5-aza-2′dC for 24 h before harvest. (H) HepG2 cells were transfected with the indicated amounts of HA-Core and HA-HBx in the presence and absence of the DNMT1 shRNA plasmid for 48 h. OD 450 , optical density at 450 nm.

    Journal: Microbiology Spectrum

    Article Title: Hepatitis B Virus X Protein Stimulates Hepatitis C Virus (HCV) Replication by Protecting HCV Core Protein from E6AP-Mediated Proteasomal Degradation

    doi: 10.1128/spectrum.01432-22

    Figure Lengend Snippet: HBx upregulates HCV core protein levels by repressing E6AP expression via DNA methylation. (A) HepG2 cells were transfected with the indicated amounts of HA-Core and HA-HBx for 48 h. DNA methyltransferase (DNMT) activity in the cell extracts was determined ( n = 6). The levels of the indicated proteins were determined by Western blotting. (B) Methylation-specific PCR (MSP) was performed to determine whether the CpG sites within the E6AP promoter were unmethylated (U) or methylated (M) in cells prepared as described above for panel A. (C) Huh7D cells were transfected with the 1.2-mer WT replicon for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h. DNMT activity in the cell extracts was determined ( n = 4). The levels of the indicated proteins were determined by Western blotting. (D) MSP was performed as described above for panel B with cells prepared as described above for panel C. (E) Huh7D-NTCP cells were either mock infected or infected with HBV at an MOI of 30 and/or HCV at an MOI of 10 for 48 h. The DNMT activity in the cell extracts was determined ( n = 4). (F) MSP was performed as described above for panel B with cells prepared as described above for panel E. (G) HepG2 cells were transfected with the indicated amounts of HA-Core and HA-HBx for 48 h. For lanes 4 to 6, cells were treated with 10 μM 5-aza-2′dC for 24 h before harvest. (H) HepG2 cells were transfected with the indicated amounts of HA-Core and HA-HBx in the presence and absence of the DNMT1 shRNA plasmid for 48 h. OD 450 , optical density at 450 nm.

    Article Snippet: The E6AP expression plasmid pCMVT N-HA-hE6AP (catalog no. 37601), encoding full-length human HA-tagged E6AP, was purchased from Addgene.

    Techniques: Expressing, DNA Methylation Assay, Transfection, Activity Assay, Western Blot, Methylation, Infection, shRNA, Plasmid Preparation

    HBx stimulates HCV replication by repressing E6AP expression via DNA methylation. (A) Huh7D cells were transfected with HA-HBx and an E6AP expression plasmid for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h, followed by Western blotting. (B) Levels of extracellular HCV particles from Huh7D cells prepared as described above for panel A were measured by qRT-PCR as described in the legend of <xref ref-type=Fig. 1B ( n = 4). (C) Huh7D cells were transfected with HA-HBx and then infected with HCV as described above for panel A, in the presence or absence of 10 μM 5-aza-2′dC. (D) Levels of extracellular HCV RNA from Huh7D cells prepared as described above for panel C were measured as described in the legend of Fig. 1B ( n = 5). (E) Huh7D cells were transfected with HA-HBx and a DNMT1 shRNA plasmid and then infected with HCV as described above for panel A, followed by Western blotting. (F) Levels of extracellular HCV RNA from Huh7D cells prepared as described above for panel E were measured as described in the legend of Fig. 1B ( n = 5). (G) Huh7D cells were transfected with the 1.2-mer WT replicon and an E6AP expression plasmid and then infected with HCV as described above for panel A. (H) Levels of extracellular HCV RNA from cells prepared as described above for panel G were measured as described in the legend of Fig. 1B ( n = 3). (I) Huh7D cells were transfected with the 1.2-mer WT replicon and then infected with HCV as described above for panel A. For lanes 4 and 5, cells were treated with 10 μM 5-aza-2′dC, as described in the legend of Fig. 4G . (J) Levels of extracellular HCV RNA from cells prepared as described above for panel I were measured as described in the legend of Fig. 1B ( n = 5). (K) Huh7D cells were transfected with the 1.2-mer WT replicon and a DNMT shRNA plasmid and then infected with HCV as described above for panel A. (L) Levels of extracellular HCV RNA from cells prepared as described above for panel K were measured as described in the legend of Fig. 1B ( n = 5). (M) Huh7D cells were transfected with HA-HBx and an E6AP shRNA plasmid and then infected with HCV as described above for panel A, followed by Western blotting. (N) Levels of extracellular HCV RNA from Huh7D cells prepared as described above for panel M were measured as described in the legend of Fig. 1B ( n = 5). (O) Huh7D cells were transfected with the 1.2-mer WT replicon and E6AP shRNA and then infected with HCV as described above for panel A. (P) Levels of extracellular HCV RNA from cells prepared as described above for panel O were measured as described in the legend of Fig. 1B ( n = 5). " width="100%" height="100%">

    Journal: Microbiology Spectrum

    Article Title: Hepatitis B Virus X Protein Stimulates Hepatitis C Virus (HCV) Replication by Protecting HCV Core Protein from E6AP-Mediated Proteasomal Degradation

    doi: 10.1128/spectrum.01432-22

    Figure Lengend Snippet: HBx stimulates HCV replication by repressing E6AP expression via DNA methylation. (A) Huh7D cells were transfected with HA-HBx and an E6AP expression plasmid for 24 h and then infected with HCV at an MOI of 10 for an additional 48 h, followed by Western blotting. (B) Levels of extracellular HCV particles from Huh7D cells prepared as described above for panel A were measured by qRT-PCR as described in the legend of Fig. 1B ( n = 4). (C) Huh7D cells were transfected with HA-HBx and then infected with HCV as described above for panel A, in the presence or absence of 10 μM 5-aza-2′dC. (D) Levels of extracellular HCV RNA from Huh7D cells prepared as described above for panel C were measured as described in the legend of Fig. 1B ( n = 5). (E) Huh7D cells were transfected with HA-HBx and a DNMT1 shRNA plasmid and then infected with HCV as described above for panel A, followed by Western blotting. (F) Levels of extracellular HCV RNA from Huh7D cells prepared as described above for panel E were measured as described in the legend of Fig. 1B ( n = 5). (G) Huh7D cells were transfected with the 1.2-mer WT replicon and an E6AP expression plasmid and then infected with HCV as described above for panel A. (H) Levels of extracellular HCV RNA from cells prepared as described above for panel G were measured as described in the legend of Fig. 1B ( n = 3). (I) Huh7D cells were transfected with the 1.2-mer WT replicon and then infected with HCV as described above for panel A. For lanes 4 and 5, cells were treated with 10 μM 5-aza-2′dC, as described in the legend of Fig. 4G . (J) Levels of extracellular HCV RNA from cells prepared as described above for panel I were measured as described in the legend of Fig. 1B ( n = 5). (K) Huh7D cells were transfected with the 1.2-mer WT replicon and a DNMT shRNA plasmid and then infected with HCV as described above for panel A. (L) Levels of extracellular HCV RNA from cells prepared as described above for panel K were measured as described in the legend of Fig. 1B ( n = 5). (M) Huh7D cells were transfected with HA-HBx and an E6AP shRNA plasmid and then infected with HCV as described above for panel A, followed by Western blotting. (N) Levels of extracellular HCV RNA from Huh7D cells prepared as described above for panel M were measured as described in the legend of Fig. 1B ( n = 5). (O) Huh7D cells were transfected with the 1.2-mer WT replicon and E6AP shRNA and then infected with HCV as described above for panel A. (P) Levels of extracellular HCV RNA from cells prepared as described above for panel O were measured as described in the legend of Fig. 1B ( n = 5).

    Article Snippet: The E6AP expression plasmid pCMVT N-HA-hE6AP (catalog no. 37601), encoding full-length human HA-tagged E6AP, was purchased from Addgene.

    Techniques: Expressing, DNA Methylation Assay, Transfection, Plasmid Preparation, Infection, Western Blot, Quantitative RT-PCR, shRNA